Recent from talks
Eteplirsen
Knowledge base stats:
Talk channels stats:
Members stats:
Eteplirsen
Eteplirsen (brand name Exondys 51) is a medication to treat, but not cure, some types of Duchenne muscular dystrophy (DMD), caused by a specific mutation. Eteplirsen only targets specific mutations and can be used to treat about 14% of DMD cases. Eteplirsen is a form of antisense therapy.
Eteplirsen was developed by Steve Wilton, Sue Fletcher and colleagues at the University of Western Australia and commercialized by Sarepta Therapeutics. After a controversial debate surrounding the drug's efficacy, during which two FDA review panel members resigned in protest, eteplirsen received accelerated approval from the US Food and Drug administration in late 2016. The Committee for Medicinal Products for Human Use (CHMP) of the European Medicines Agency (EMA) refused to authorize the use of eteplirsen.
The following adverse events were observed in at least 10% of people who received eteplirsen in trials: vomiting, contusion, excoriation, arthralgia, rash, catheter site pain, and upper respiratory tract infection.
Duchenne muscular dystrophy is caused when a mutation in the DMD gene changes the DMD mRNA so that it no longer codes for functional dystrophin protein, usually due to a nonsense mutation that introduces a premature stop codon into the mRNA.[citation needed] If an exon with an appropriate number of bases lies near the mutation, by removing the defective exon the downstream reading frame can be corrected and production of partially functional dystrophin can be restored.[citation needed] This is the general strategy used for designing exon-skipping oligos for DMD; as there are 79 exons transcribed in the longest splice form of the dystrophin transcript, many different oligos are needed to address the range of mutations present in the population of people with DMD.[citation needed]
Eteplirsen is a morpholino antisense oligomer which triggers excision of exon 51 during pre-mRNA splicing of the dystrophin RNA transcript. Skipping exon 51 changes the downstream reading frame of dystrophin; giving eteplirsen to a healthy person would result in production of dystrophin mRNA which would not code for functional dystrophin protein but, for DMD patients with particular nonsense mutations, giving eteplirsen can restore the reading frame of the dystrophin mRNA and result in production of functional (although modified by having an internal deletion consisting of both the patient's original defect, as well as the therapeutically skipped exon) dystrophin. Eteplirsen is given by intravenous infusion for systemic treatment of DMD.
Exon skipping is induced by eteplirsen, a charge-neutral, phosphorodiamidate morpholino oligomer (PMO) that selectively binds to exon 51 of dystrophin pre-mRNA, restoring the phase of the reading frame and enabling production of functional, but internally edited, dystrophin. The uncharged nature of the PMO helps make it resistant to biological degradation. This modified dystrophin protein produced by eteplirsen may cause a less severe form of dystrophinopathy, much like Becker muscular dystrophy. Eteplirsen's proposed mechanism of action is to bind to dystrophin pre-mRNA and alter the exon splicing of the RNA so that more almost full-length dystrophin is made. By increasing the quantity of an abnormal, but potentially functional, dystrophin protein, the objective is to slow or prevent the progression of DMD.
Eteplirsen is a morpholino phosphorodiamidate antisense oligomer.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488),
30-mer,
20% G,
43% CG,
Predicted Tm: 88.9 °C at 10 μM oligo.
Hub AI
Eteplirsen AI simulator
(@Eteplirsen_simulator)
Eteplirsen
Eteplirsen (brand name Exondys 51) is a medication to treat, but not cure, some types of Duchenne muscular dystrophy (DMD), caused by a specific mutation. Eteplirsen only targets specific mutations and can be used to treat about 14% of DMD cases. Eteplirsen is a form of antisense therapy.
Eteplirsen was developed by Steve Wilton, Sue Fletcher and colleagues at the University of Western Australia and commercialized by Sarepta Therapeutics. After a controversial debate surrounding the drug's efficacy, during which two FDA review panel members resigned in protest, eteplirsen received accelerated approval from the US Food and Drug administration in late 2016. The Committee for Medicinal Products for Human Use (CHMP) of the European Medicines Agency (EMA) refused to authorize the use of eteplirsen.
The following adverse events were observed in at least 10% of people who received eteplirsen in trials: vomiting, contusion, excoriation, arthralgia, rash, catheter site pain, and upper respiratory tract infection.
Duchenne muscular dystrophy is caused when a mutation in the DMD gene changes the DMD mRNA so that it no longer codes for functional dystrophin protein, usually due to a nonsense mutation that introduces a premature stop codon into the mRNA.[citation needed] If an exon with an appropriate number of bases lies near the mutation, by removing the defective exon the downstream reading frame can be corrected and production of partially functional dystrophin can be restored.[citation needed] This is the general strategy used for designing exon-skipping oligos for DMD; as there are 79 exons transcribed in the longest splice form of the dystrophin transcript, many different oligos are needed to address the range of mutations present in the population of people with DMD.[citation needed]
Eteplirsen is a morpholino antisense oligomer which triggers excision of exon 51 during pre-mRNA splicing of the dystrophin RNA transcript. Skipping exon 51 changes the downstream reading frame of dystrophin; giving eteplirsen to a healthy person would result in production of dystrophin mRNA which would not code for functional dystrophin protein but, for DMD patients with particular nonsense mutations, giving eteplirsen can restore the reading frame of the dystrophin mRNA and result in production of functional (although modified by having an internal deletion consisting of both the patient's original defect, as well as the therapeutically skipped exon) dystrophin. Eteplirsen is given by intravenous infusion for systemic treatment of DMD.
Exon skipping is induced by eteplirsen, a charge-neutral, phosphorodiamidate morpholino oligomer (PMO) that selectively binds to exon 51 of dystrophin pre-mRNA, restoring the phase of the reading frame and enabling production of functional, but internally edited, dystrophin. The uncharged nature of the PMO helps make it resistant to biological degradation. This modified dystrophin protein produced by eteplirsen may cause a less severe form of dystrophinopathy, much like Becker muscular dystrophy. Eteplirsen's proposed mechanism of action is to bind to dystrophin pre-mRNA and alter the exon splicing of the RNA so that more almost full-length dystrophin is made. By increasing the quantity of an abnormal, but potentially functional, dystrophin protein, the objective is to slow or prevent the progression of DMD.
Eteplirsen is a morpholino phosphorodiamidate antisense oligomer.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488),
30-mer,
20% G,
43% CG,
Predicted Tm: 88.9 °C at 10 μM oligo.