Community hub
Recent from talks
Contribute something
Nothing was collected or created yet.
Alternative flatworm mitochondrial code
View on WikipediaThe alternative flatworm mitochondrial code (translation table 14) is a genetic code found in the mitochondria of Platyhelminthes and Nematodes.
Code
[edit]AAs = FFLLSSSSYYY*CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
[edit]| DNA codons | RNA codons | This code (14) | Standard code (1) | |
|---|---|---|---|---|
AAA |
AAA |
Asn (N) |
Lys (K)
| |
AGA |
AGA |
Ser (S) |
Arg (R)
| |
AGG |
AGG |
Ser (S) |
Arg (R)
| |
TAA |
UAA |
Tyr (Y) |
STOP = Ter (*)
| |
TGA |
UGA |
Trp (W) |
STOP = Ter (*)
|
Systematic range and comments
[edit]- Platyhelminthes (flatworms) and Nematoda (roundworms).
Code 14 differs from code 9 (the echinoderm and flatworm mitochondrial code) only by translating UAA to Tyr rather than STOP. A study in 2000[1] has found no evidence that the codon UAA codes for Tyr in the flatworms but other opinions exist. There are very few GenBank records that are translated with code 14 but a test translation shows that re-translating these records with code 9 can cause premature terminations. More recently, UAA has been found to code for tyrosine in the nematodes Radopholus similis[2] and Radopholus arabocoffeae.[3]
See also
[edit]References
[edit]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [4]
- ^ Telford MJ, Herniou EA, Russell RB, Littlewood DT (October 2000). "Changes in mitochondrial genetic codes as phylogenetic characters: two examples from the flatworms". Proceedings of the National Academy of Sciences USA. 10. 97 (21): 11359–64. Bibcode:2000PNAS...9711359T. doi:10.1073/pnas.97.21.11359. PMC 17205. PMID 11027335.
- ^ Joachim EM Jacob; Bartel Vanholme; Thomas Van Leeuwen & Godelieve Gheysen (2009). "A unique genetic code change in the mitochondrial genome of the parasitic nematode Radopholus similis". BMC Res Notes. 2: 192. doi:10.1186/1756-0500-2-192. PMC 2761399. PMID 19778425.
- ^ "Taxonomy browser (Radopholus arabocoffeae)".
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 1 July 2016.
 | This genetics article is a stub. You can help Wikipedia by expanding it. |