Community hub
Recent from talks
Contribute something
Nothing was collected or created yet.
Cephalodiscidae mitochondrial code
View on WikipediaThe Cephalodiscidae mitochondrial code (translation table 33) is a genetic code used by the mitochondrial genome of Cephalodiscidae (Pterobranchia). The Pterobranchia are one of the two groups in the Hemichordata which together with the Echinodermata and Chordata form the major clades of deuterostomes.
Code 33 is very similar to the mitochondrial code 24 for the Pterobranchia, which also belong to the Hemichordata, except that it uses UAA for tyrosine rather than as a stop codon.[1]
This code shares with many other mitochondrial codes the reassignment of the UGA STOP to tryptophan, and AGG and AGA to an amino acid other than arginine. However, the assignment of AGG to lysine in pterobranchian mitogenomes is not found elsewhere in deuterostome mitochondria but it occurs in some taxa of Arthropoda.[2]
The code
[edit]AAs = FFLLSSSSYYY*CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSSKVVVVAAAADDEEGGGGStarts = ---M-------*-------M---------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
[edit]| DNA codons | RNA codons | This code (33) | Standard code (1) | |
|---|---|---|---|---|
TAA |
UAA |
Tyr (Y) |
STOP = Ter (*)
| |
TGA |
UGA |
Trp (W) |
STOP = Ter (*)
| |
AGA |
AGA |
Ser (S) |
Arg (R)
| |
AGG |
AGG |
Lys (K) |
Arg (R)
|
See also
[edit]References
[edit]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ^ Li, Yuanning; Kocot, Kevin M.; Tassia, Michael G.; Cannon, Johanna T.; Bernt, Matthias; Halanych, Kenneth M. (2019-01-01). "Mitogenomics Reveals a Novel Genetic Code in Hemichordata". Genome Biology and Evolution. 11 (1): 29–40. doi:10.1093/gbe/evy254. PMC 6319601. PMID 30476024.
- ^ Perseke M, Hetmank J, Bernt M, Stadler PF, Schlegel M, Bernhard D (May 2011). "The enigmatic mitochondrial genome of Rhabdopleura compacta (Pterobranchia) reveals insights into selection of an efficient tRNA system and supports monophyly of Ambulacraria". BMC Evol Biol. 11 (134): 134. Bibcode:2011BMCEE..11..134P. doi:10.1186/1471-2148-11-134. PMC 3121625. PMID 21599892.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 7 January 2019.