Community hub
0 subscribers7 pages, 0 posts
Recent from talks
All channels
Be the first to start a discussion here.
Be the first to start a discussion here.
Be the first to start a discussion here.
Be the first to start a discussion here.
Contribute something
Welcome to the community hub built to collect knowledge and have discussions related to Yeast mitochondrial code.
Nothing was collected or created yet.
Yeast mitochondrial code
View on Wikipediafrom Wikipedia
The yeast mitochondrial code (translation table 3) is a genetic code used by the mitochondrial genome of yeasts, notably Saccharomyces cerevisiae, Candida glabrata, Hansenula saturnus, and Kluyveromyces thermotolerans.[1]
The code
[edit]AAs = FFLLSSSSYY**CCWWTTTTPPPPHHQQRRRRIIMMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = ---M---------------M---------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
[edit]| DNA codons | RNA codons | This code (3) | Standard code (1) | |
|---|---|---|---|---|
ATA |
AUA |
Met (M) |
Ile (I)
| |
CTT |
CUU |
Thr (T) |
Leu (L)
| |
CTC |
CUC |
Thr (T) |
Leu (L)
| |
CTA |
CUA |
Thr (T) |
Leu (L)
| |
CTG |
CUG |
Thr (T) |
Leu (L)
| |
TGA |
UGA |
Trp (W) |
STOP = Ter (*)
| |
CGA |
CGA |
Absent |
Arg (R)
| |
CGC |
CGC |
Absent |
Arg (R)
|
- The remaining CGN codons are rare in Saccharomyces cerevisiae[2] and absent in Candida glabrata.
- The AUA codon is common in the gene var1 coding for the single mitochondrial ribosomal protein, but rare in genes encoding the enzymes.
- The coding assignments of the AUA (Met or Ile) and CUU (possibly Leu, not Thr) are uncertain in Hansenula saturnus.
- The coding assignment of Thr to CUN is uncertain in Kluyveromyces thermotolerans.
See also
[edit]References
[edit]This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ^ Clark-Walker, G. D.; Weiller, G. F. (1994). "The structure of the small mitochondrial DNA of Kluyveromyces thermotolerans is likely to reflect the ancestral gene order in fungi". Journal of Molecular Evolution. 38 (6): 593–601. Bibcode:1994JMolE..38..593C. doi:10.1007/bf00175879. PMID 8083884. S2CID 10510397.
- ^ Susan G. Bonitz, Roberta Berlani, Gloria Coruzzi, May Li, Giuseppe Macino, Francisco G. Nobrega, Marina P. Nobrega, Arbara E. Thalenfeld and Alexander Tzagoloff (June 1980). "Codon recognition rules in yeast mitochondria" (PDF). Proc. Natl. Acad. Sci. USA. 77 (6): 3167–3170. Bibcode:1980PNAS...77.3167B. doi:10.1073/pnas.77.6.3167. PMC 349575. PMID 6997870.
{{cite journal}}: CS1 maint: multiple names: authors list (link) - ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 30 April 2015.