Hubbry Logo
Transfer RNATransfer RNAMain
Open search
Transfer RNA
Community hub
Transfer RNA
logo
8 pages, 0 posts
0 subscribers
Be the first to start a discussion here.
Be the first to start a discussion here.
Transfer RNA
Transfer RNA
Transfer RNA
View on Wikipedia
from Wikipedia
tRNA
Illustration of tRNA in translation
Identifiers
Symbolt
RfamRF00005
Other data
RNA typegene, tRNA
PDB structuresPDBe 3icq, 1asy, 1asz, 1il2, 2tra, 3tra, 486d, 1fir, 1yfg, 3eph, 3epj, 3epk, 3epl, 1efw, 1c0a, 2ake, 2azx, 2dr2, 1f7u, 1f7v, 3foz, 2hgp, 2j00, 2j02, 2ow8, 2v46, 2v48, 2wdg, 2wdh, 2wdk, 2wdm, 2wh1

Transfer ribonucleic acid (tRNA), formerly referred to as soluble ribonucleic acid (sRNA),[1] is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length (in eukaryotes).[2] In a cell, it provides the physical link between the genetic code in messenger RNA (mRNA) and the amino acid sequence of proteins, carrying the correct sequence of amino acids to be combined by the protein-synthesizing machinery, the ribosome. Each three-nucleotide codon in mRNA is complemented by a three-nucleotide anticodon in tRNA. As such, tRNAs are a necessary component of translation, the biological synthesis of new proteins in accordance with the genetic code.

Overview

[edit]

The process of translation starts with the information stored in the nucleotide sequence of DNA. This is first transformed into mRNA, then tRNA specifies which three-nucleotide codon from the genetic code corresponds to which amino acid.[3] Each mRNA codon is recognized by a particular type of tRNA, which docks to it along a three-nucleotide anticodon, and together they form three complementary base pairs.

On the other end of the tRNA is a covalent attachment to the amino acid corresponding to the anticodon sequence, with each type of tRNA attaching to a specific amino acid. Because the genetic code contains multiple codons that specify the same amino acid, there are several tRNA molecules bearing different anticodons which carry the same amino acid.

The covalent attachment to the tRNA 3' end is catalysed by enzymes called aminoacyl tRNA synthetases. During protein synthesis, tRNAs with attached amino acids are delivered to the ribosome by proteins called elongation factors, which aid in association of the tRNA with the ribosome, synthesis of the new polypeptide, and translocation (movement) of the ribosome along the mRNA. If the tRNA's anticodon matches the mRNA, another tRNA already bound to the ribosome transfers the growing polypeptide chain from its 3' end to the amino acid attached to the 3' end of the newly delivered tRNA, a reaction catalyzed by the ribosome. A large number of the individual nucleotides in a tRNA molecule may be chemically modified, often by methylation or deamidation. These unusual bases sometimes affect the tRNA's interaction with ribosomes and sometimes occur in the anticodon to alter base-pairing properties.[4]

The addition of a guanine nucleotide at the -1 position (G-1) to the 5′ end of tRNA-His, catalyzed by tRNA-His guanylyltransferase (Thg1) and Thg1-like proteins (TLPs) is particularly notable as it proceeds in the 3′ to 5′ direction, which is opposite to the canonical 5′ to 3′ nucleotide addition used by all other known nucleic acid polymerases.[5] This reverse polymerization mechanism is biochemically unique and evolutionarily conserved, highlighting its fundamental importance in tRNA maturation.[6] Homologs of Thg1 are found in all domains of life, where they can also participate in tRNA repair and quality control.[7] The presence of G-1 is a key identity element for tRNA-His, and its absence severely impairs histidylation efficiency and tRNA function.

Structure

[edit]
Secondary cloverleaf structure of a tRNA encoding for phenylalanine.
Tertiary structure of tRNA. CCA tail in yellow, acceptor stem in purple, variable loop in orange, D arm in red, anticodon arm in blue with anticodon in black, T arm in green.
3D animated GIF showing the structure of phenylalanine-tRNA from yeast (PDB ID 1ehz). White lines indicate base pairing by hydrogen bonds. In the orientation shown, the acceptor stem is on top and the anticodon on the bottom.[8]

The structure of tRNA can be decomposed into its primary structure, its secondary structure (usually visualized as the cloverleaf structure), and its tertiary structure[9] (all tRNAs have a similar L-shaped 3D structure that allows them to fit into the P and A sites of the ribosome). The cloverleaf structure becomes the 3D L-shaped structure through coaxial stacking of the helices, which is a common RNA tertiary structure motif. The lengths of each arm, as well as the loop 'diameter', in a tRNA molecule vary from species to species.[9][10] The tRNA structure consists of the following:

  • The acceptor stem is a 7- to 9-base pair (bp) stem made by the base pairing of the 5′-terminal nucleotide with the 3′-terminal nucleotide (which contains the CCA tail used to attach the amino acid). The acceptor stem may contain non-Watson-Crick base pairs.[9][11]
  • The CCA tail is a cytosine-cytosine-adenine sequence at the 3′ end of the tRNA molecule. The amino acid loaded onto the tRNA by aminoacyl tRNA synthetases, to form aminoacyl-tRNA, is covalently bonded to the 3′-hydroxyl group on the CCA tail.[12] This sequence is important for the recognition of tRNA by enzymes and critical in translation.[13][14] In prokaryotes, the CCA sequence is transcribed in some tRNA sequences. In most prokaryotic tRNAs and eukaryotic tRNAs, the CCA sequence is added during processing and therefore does not appear in the tRNA gene.[15]
  • The D loop is a 4- to 6-bp stem ending in a loop that often contains dihydrouridine.[9]
  • The anticodon loop is a 5-bp stem whose loop contains the anticodon.[9]
  • The TΨC loop is named so because of the characteristic presence of the unusual base Ψ in the loop, where Ψ is pseudouridine, a modified uridine. The modified base is often found within the sequence 5'-TΨCGA-3', with the T (ribothymidine, m5U) and A forming a base pair.[16]
  • The variable loop or V loop sits between the anticodon loop and the ΨU loop and, as its name implies, varies in size from 3 to 21 bases. In some tRNAs, the "loop" is long enough to form a rigid stem, the variable arm.[17] tRNAs with a V loop more than 10 bases long is classified as "class II" and the rest is called "class I".[18]

Anticodon

[edit]

An anticodon[19] is a unit of three nucleotides corresponding to the three bases of an mRNA codon. Each tRNA has a distinct anticodon triplet sequence that can form 3 complementary base pairs to one or more codons for an amino acid. Some anticodons pair with more than one codon due to wobble base pairing. Frequently, the first nucleotide of the anticodon is one not found on mRNA: inosine, which can hydrogen bond to more than one base in the corresponding codon position.[4]: 29.3.9  In genetic code, it is common for a single amino acid to be specified by all four third-position possibilities, or at least by both pyrimidines and purines; for example, the amino acid glycine is coded for by the codon sequences GGU, GGC, GGA, and GGG. Other modified nucleotides may also appear at the first anticodon position—sometimes known as the "wobble position"—resulting in subtle changes to the genetic code, as for example in mitochondria.[20] The possibility of wobble bases reduces the number of tRNA types required: instead of 61 types with one for each sense codon of the standard genetic code), only 31 tRNAs are required to translate, unambiguously, all 61 sense codons.[3][21]

Nomenclature

[edit]

A tRNA is commonly named by its intended amino acid (e.g. tRNA-Asn), by its anticodon sequence (e.g. tRNA(GUU)), or by both (e.g. tRNA-Asn(GUU) or tRNAAsn
GUU).[22] These two features describe the main function of the tRNA, but do not actually cover the whole diversity of tRNA variation; as a result, numerical suffixes are added to differentiate.[23] tRNAs intended for the same amino acid are called "isotypes"; when isotypes also share the same anticodon they are called "isoacceptors"; and when isotypes have an identical mature sequence they are called "isodecoders".[24]

Aminoacylation

[edit]
See also: Aminoacyl-tRNA

Aminoacylation is the process of adding an aminoacyl group to a compound. It covalently links an amino acid to the CCA 3′ end of a tRNA molecule. Each tRNA is aminoacylated (or charged) with a specific amino acid by an aminoacyl tRNA synthetase. There is normally a single aminoacyl tRNA synthetase for each amino acid, despite the fact that there can be more than one tRNA, and more than one anticodon for an amino acid. Recognition of the appropriate tRNA by the synthetases is not mediated solely by the anticodon, and the acceptor stem often plays a prominent role.[25] Reaction:

  1. amino acid + ATP → aminoacyl-AMP + PPi
  2. aminoacyl-AMP + tRNA → aminoacyl-tRNA + AMP

Certain organisms can have one or more aminophosphate-tRNA synthetases missing. This leads to charging of the tRNA by a chemically related amino acid, and by use of an enzyme or enzymes, the tRNA is modified to be correctly charged. For example, Helicobacter pylori has glutaminyl tRNA synthetase missing. Thus, glutamate tRNA synthetase charges tRNA-glutamine(tRNA-Gln) with glutamate. An amidotransferase then converts the acid side chain of the glutamate to the amide, forming the correctly charged gln-tRNA-Gln.

Binding to ribosome

[edit]
The range of conformations adopted by tRNA as it transits the A/T through P/E sites on the ribosome. The Protein Data Bank (PDB) codes for the structural models used as end points of the animation are given. Both tRNAs are modeled as phenylalanine-specific tRNA from Escherichia coli, with the A/T tRNA as a homology model of the deposited coordinates. Color coding as shown for tRNA tertiary structure. Adapted from.[26]

The ribosome has three binding sites for tRNA molecules that span the space between the two ribosomal subunits: the A (aminoacyl),[27] P (peptidyl), and E (exit) sites. In addition, the ribosome has two other sites for tRNA binding that are used during mRNA decoding or during the initiation of protein synthesis. These are the T site (named elongation factor Tu) and I site (initiation).[28][29] By convention, the tRNA binding sites are denoted with the site on the small ribosomal subunit listed first and the site on the large ribosomal subunit listed second. For example, the A site is often written A/A, the P site, P/P, and the E site, E/E.[28] The binding proteins like L27, L2, L14, L15, L16 at the A- and P- sites have been determined by affinity labeling by A. P. Czernilofsky et al. (Proc. Natl. Acad. Sci, USA, pp. 230–234, 1974).

Once translation initiation is complete, the first aminoacyl tRNA is located in the P/P site, ready for the elongation cycle described below. During translation elongation, tRNA first binds to the ribosome as part of a complex with elongation factor Tu (EF-Tu) or its eukaryotic (eEF-1) or archaeal counterpart. This initial tRNA binding site is called the A/T site. In the A/T site, the A-site half resides in the small ribosomal subunit where the mRNA decoding site is located. The mRNA decoding site is where the mRNA codon is read out during translation. The T-site half resides mainly on the large ribosomal subunit where EF-Tu or eEF-1 interacts with the ribosome. Once mRNA decoding is complete, the aminoacyl-tRNA is bound in the A/A site and is ready for the next peptide bond[30] to be formed to its attached amino acid. The peptidyl-tRNA, which transfers the growing polypeptide to the aminoacyl-tRNA bound in the A/A site, is bound in the P/P site. Once the peptide bond is formed, the tRNA in the P/P site is acylated, or has a free 3' end, and the tRNA in the A/A site dissociates the growing polypeptide chain. To allow for the next elongation cycle, the tRNAs then move through hybrid A/P and P/E binding sites, before completing the cycle and residing in the P/P and E/E sites. Once the A/A and P/P tRNAs have moved to the P/P and E/E sites, the mRNA has also moved over by one codon and the A/T site is vacant, ready for the next round of mRNA decoding. The tRNA bound in the E/E site then leaves the ribosome.

The P/I site is actually the first to bind to aminoacyl tRNA, which is delivered by an initiation factor called IF2 in bacteria.[29] However, the existence of the P/I site in eukaryotic or archaeal ribosomes has not yet been confirmed. The P-site protein L27 has been determined by affinity labeling by E. Collatz and A. P. Czernilofsky (FEBS Lett., Vol. 63, pp. 283–286, 1976).

tRNA genes

[edit]

Organisms vary in the number of tRNA genes in their genome. For example, the nematode worm C. elegans, a commonly used model organism in genetics studies, has 29,647 genes in its nuclear genome,[31] of which 620 code for tRNA.[32][33] The budding yeast Saccharomyces cerevisiae has 275 tRNA genes in its genome. The number of tRNA genes per genome can vary widely, with bacterial species from groups such as Fusobacteria and Tenericutes having around 30 genes per genome while complex eukaryotic genomes such as the zebrafish (Danio rerio) can bear more than 10 thousand tRNA genes.[34]

In the human genome, which, according to January 2013 estimates, has about 20,848 protein coding genes [35] in total, there are 497 nuclear genes encoding cytoplasmic tRNA molecules, and 324 tRNA-derived pseudogenes—tRNA genes thought to be no longer functional[36] (although pseudo tRNAs have been shown to be involved in antibiotic resistance in bacteria).[37] As with all eukaryotes, there are 22 mitochondrial tRNA genes[38] in humans. Mutations in some of these genes have been associated with severe diseases like the MELAS syndrome. Regions in nuclear chromosomes, very similar in sequence to mitochondrial tRNA genes, have also been identified (tRNA-lookalikes).[39] These tRNA-lookalikes are also considered part of the nuclear mitochondrial DNA (genes transferred from the mitochondria to the nucleus).[39][40] The phenomenon of multiple nuclear copies of mitochondrial tRNA (tRNA-lookalikes) has been observed in many higher organisms from human to the opossum[41] suggesting the possibility that the lookalikes are functional.

In humans, cytoplasmic tRNA genes can be grouped into 49 families according to their anticodon features. These genes are found on all chromosomes, except the 22 and Y chromosome. High clustering on 6p is observed (140 tRNA genes), as well as on chromosome 1.[36]

The HGNC, in collaboration with the Genomic tRNA Database (GtRNAdb) and experts in the field, has approved unique names for human genes that encode tRNAs.

Typically, tRNAs genes from Bacteria are shorter (mean = 77.6 bp) than tRNAs from Archaea (mean = 83.1 bp) and eukaryotes (mean = 84.7 bp).[34] The mature tRNA follows an opposite pattern with tRNAs from Bacteria being usually longer (median = 77.6 nt) than tRNAs from Archaea (median = 76.8 nt), with eukaryotes exhibiting the shortest mature tRNAs (median = 74.5 nt).[34]

Evolution

[edit]

Genomic tRNA content is a differentiating feature of genomes among biological domains of life: Archaea present the simplest situation in terms of genomic tRNA content with a uniform number of gene copies, Bacteria have an intermediate situation and Eukarya present the most complex situation.[42] Eukarya present not only more tRNA gene content than the other two kingdoms but also a high variation in gene copy number among different isoacceptors, and this complexity seem to be due to duplications of tRNA genes and changes in anticodon specificity [citation needed].

Evolution of the tRNA gene copy number across different species has been linked to the appearance of specific tRNA modification enzymes (uridine methyltransferases in Bacteria, and adenosine deaminases in Eukarya), which increase the decoding capacity of a given tRNA.[42] As an example, tRNAAla encodes four different tRNA isoacceptors (AGC, UGC, GGC and CGC). In Eukarya, AGC isoacceptors are extremely enriched in gene copy number in comparison to the rest of isoacceptors, and this has been correlated with its A-to-I modification of its wobble base. This same trend has been shown for most amino acids of eukaryal species. Indeed, the effect of these two tRNA modifications is also seen in codon usage bias. Highly expressed genes seem to be enriched in codons that are exclusively using codons that will be decoded by these modified tRNAs, which suggests a possible role of these codons—and consequently of these tRNA modifications—in translation efficiency.[42]

Many species have lost specific tRNAs during evolution. For instance, both mammals and birds lack the same 14 out of the possible 64 tRNA genes, but other life forms contain these tRNAs.[43] For translating codons for which an exactly pairing tRNA is missing, organisms resort to a strategy called wobbling, in which imperfectly matched tRNA/mRNA pairs still give rise to translation, although this strategy also increases the propensity for translation errors.[44] The reasons why tRNA genes have been lost during evolution remains under debate but may relate improving resistance to viral infection.[45] Because nucleotide triplets can present more combinations than there are amino acids and associated tRNAs, there is redundancy in the genetic code, and several different 3-nucleotide codons can express the same amino acid. This codon bias is what necessitates codon optimization.

Hypothetical origin

[edit]

The top half of tRNA (consisting of the T arm and the acceptor stem with 5′-terminal phosphate group and 3′-terminal CCA group) and the bottom half (consisting of the D arm and the anticodon arm) are independent units in structure as well as in function. The top half may have evolved first including the 3′-terminal genomic tag which originally may have marked tRNA-like molecules for replication in early RNA world. The bottom half may have evolved later as an expansion, e.g. as protein synthesis started in RNA world and turned it into a ribonucleoprotein world (RNP world). This proposed scenario is called genomic tag hypothesis. In fact, tRNA and tRNA-like aggregates have an important catalytic influence (i.e., as ribozymes) on replication still today. These roles may be regarded as 'molecular (or chemical) fossils' of RNA world.[46] In March 2021, researchers reported evidence suggesting that an early form of transfer RNA could have been a replicator ribozyme molecule in the very early development of life, or abiogenesis.[47][48]

Evolution of type I and type II tRNAs is explained to the last nucleotide by the three 31 nucleotide minihelix tRNA evolution theorem, which also describes the pre-life to life transition on Earth.[49][50][51][52][53] Three 31 nucleotide minihelices of known sequence were ligated in pre-life to generate a 93 nucleotide tRNA precursor. In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation.

Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.

tRNA-derived fragments

[edit]

tRNA-derived fragments (or tRFs) are short molecules that emerge after cleavage of the mature tRNAs or the precursor transcript.[54][55][56][57] Both cytoplasmic and mitochondrial tRNAs can produce fragments.[58] There are at least four structural types of tRFs believed to originate from mature tRNAs, including the relatively long tRNA halves and short 5'-tRFs, 3'-tRFs and i-tRFs.[54][58][59] The precursor tRNA can be cleaved to produce molecules from the 5' leader or 3' trail sequences. Cleavage enzymes include Angiogenin, Dicer, RNase Z and RNase P.[54][55] Especially in the case of Angiogenin, the tRFs have a characteristically unusual cyclic phosphate at their 3' end and a hydroxyl group at the 5' end.[60] tRFs appear to play a role in RNA interference, specifically in the suppression of retroviruses and retrotransposons that use tRNA as a primer for replication. Half-tRNAs cleaved by angiogenin are also known as tiRNAs. The biogenesis of smaller fragments, including those that function as piRNAs, are less understood.[61]

tRFs have multiple dependencies and roles; such as exhibiting significant changes between sexes, among races and disease status.[58][62][63] Functionally, they can be loaded on Ago and act through RNAi pathways,[56][59][64] participate in the formation of stress granules,[65] displace mRNAs from RNA-binding proteins[66] or inhibit translation.[67] At the system or the organismal level, the four types of tRFs have a diverse spectrum of activities. Functionally, tRFs are associated with viral infection,[68] cancer,[59] cell proliferation [60] and also with epigenetic transgenerational regulation of metabolism.[69]

tRFs are not restricted to humans and have been shown to exist in multiple organisms.[59][70][71][72]

Two online tools are available for those wishing to learn more about tRFs: the framework for the interactive exploration of mitochondrial and nuclear tRNA fragments (MINTbase)[73][74] and the relational database of Transfer RNA related Fragments (tRFdb).[75] MINTbase also provides a naming scheme for the naming of tRFs called tRF-license plates (or MINTcodes) that is genome independent; the scheme compresses an RNA sequence into a shorter string.

Engineered tRNAs

[edit]
Main article: Genetic code expansion

tRNAs with modified anticodons and/or acceptor stems can be used to modify the genetic code. Scientists have successfully repurposed codons (sense and stop) to accept amino acids (natural and novel), for both initiation (see: start codon) and elongation.

In 1990, tRNAfMet2
CUA (modified from the tRNAfMet2
CAU gene metY) was inserted into E. coli, causing it to initiate protein synthesis at the UAG stop codon, as long as it is preceded by a strong Shine-Dalgarno sequence. At initiation it not only inserts the traditional formylmethionine, but also formylglutamine, as glutamyl-tRNA synthase also recognizes the new tRNA.[76] The experiment was repeated in 1993, now with an elongator tRNA modified to be recognized by the methionyl-tRNA formyltransferase.[77] A similar result was obtained in Mycobacterium.[78] Later experiments showed that the new tRNA was orthogonal to the regular AUG start codon showing no detectable off-target translation initiation events in a genomically recoded E. coli strain.[79]

tRNA biogenesis

[edit]

In eukaryotic cells, tRNAs are transcribed by RNA polymerase III as pre-tRNAs in the nucleus.[80] RNA polymerase III recognizes two highly conserved downstream promoter sequences: the 5′ intragenic control region (5′-ICR, D-control region, or A box), and the 3′-ICR (T-control region or B box) inside tRNA genes.[2][81][82] The first promoter begins at +8 of mature tRNAs and the second promoter is located 30–60 nucleotides downstream of the first promoter. The transcription terminates after a stretch of four or more thymidines.[2][82]

Bulge-helix-bulge motif of a tRNA intron

Pre-tRNAs undergo extensive modifications inside the nucleus. Some pre-tRNAs contain introns that are spliced, or cut, to form the functional tRNA molecule;[83] in bacteria these self-splice, whereas in eukaryotes and archaea they are removed by tRNA-splicing endonucleases.[84] Eukaryotic pre-tRNA contains bulge-helix-bulge (BHB) structure motif that is important for recognition and precise splicing of tRNA intron by endonucleases.[85] This motif position and structure are evolutionarily conserved. However, some organisms, such as unicellular algae have a non-canonical position of BHB-motif as well as 5′- and 3′-ends of the spliced intron sequence.[85] The 5′ sequence is removed by RNase P,[86] whereas the 3′ end is removed by the tRNase Z enzyme.[87] A notable exception is in the archaeon Nanoarchaeum equitans, which does not possess an RNase P enzyme and has a promoter placed such that transcription starts at the 5′ end of the mature tRNA.[88] The non-templated 3′ CCA tail is added by a nucleotidyl transferase.[89] Before tRNAs are exported into the cytoplasm by Los1/Xpo-t,[90][91] tRNAs are aminoacylated.[92] The order of the processing events is not conserved. For example, in yeast, the splicing is not carried out in the nucleus but at the cytoplasmic side of mitochondrial membranes.[93]

History

[edit]

The existence of tRNA was first hypothesized by Francis Crick as the "adaptor hypothesis" based on the assumption that there must exist an adapter molecule capable of mediating the translation of the RNA alphabet into the protein alphabet. Paul C Zamecnik, Mahlon Hoagland, and Mary Louise Stephenson discovered tRNA.[94][95][96] Significant research on structure was conducted in the early 1960s by Alex Rich and Donald Caspar, two researchers in Boston, the Jacques Fresco group in Princeton University and a United Kingdom group at King's College London.[97] In 1965, Robert W. Holley of Cornell University reported the primary structure and suggested three secondary structures.[98] tRNA was first crystallized in Madison, Wisconsin, by Robert M. Bock.[99] The cloverleaf structure was ascertained by several other studies in the following years[100] and was finally confirmed using X-ray crystallography studies in 1974. Two independent groups, Kim Sung-Hou working under Alexander Rich and a British group headed by Aaron Klug, published the same crystallography findings within a year.[101][102]

Clinical relevance

[edit]

Interference with aminoacylation may be useful as an approach to treating some diseases: cancerous cells may be relatively vulnerable to disturbed aminoacylation compared to healthy cells. The protein synthesis associated with cancer and viral biology is often very dependent on specific tRNA molecules. For instance, for liver cancer charging tRNA-Lys-CUU with lysine sustains liver cancer cell growth and metastasis, whereas healthy cells have a much lower dependence on this tRNA to support cellular physiology.[103] Similarly, hepatitis E virus requires a tRNA landscape that substantially differs from that associated with uninfected cells.[104] Hence, inhibition of aminoacylation of specific tRNA species is considered a promising novel avenue for the rational treatment of a plethora of diseases.

See also

[edit]

References

[edit]
[edit]
Revisions and contributorsEdit on WikipediaRead on Wikipedia

Transfer RNA

View on Grokipedia
from Grokipedia
Transfer RNA (tRNA), formerly known as soluble RNA (sRNA), is a class of short, molecules that play a central role in protein synthesis by acting as adaptors between the nucleotide sequence of (mRNA) and the corresponding sequence of proteins. These molecules, typically comprising 70 to 90 , are aminoacylated with specific at their 3' end and recognize complementary codons on mRNA via their anticodon loops, ensuring accurate translation of the during ribosome-mediated polypeptide assembly. tRNAs are ubiquitous across all domains of life and exhibit extensive post-transcriptional modifications that enhance their stability, folding, and decoding fidelity. The secondary structure of tRNA adopts a characteristic cloverleaf conformation, featuring four main arms: the acceptor stem for attachment, the D-arm involved in recognition by aminoacyl-tRNA synthetases, the anticodon arm for codon-anticodon pairing, and the T-arm that interacts with ribosomal proteins. In three dimensions, tRNAs fold into an L-shaped tertiary structure, with the anticodon at one end and the -binding site at the other, approximately 70 apart, which facilitates their precise positioning within the ribosome's , and E sites during elongation. This conserved architecture, preserved through billions of years of , underscores tRNA's ancient origins, with molecular fossils suggesting it predates the and may have contributed to the emergence of the . In the process of , tRNAs are first charged with their cognate by aminoacyl-tRNA synthetases (aaRS), enzymes that ensure specificity through recognition of both the tRNA's identity elements and the substrate. Once loaded, tRNAs enter the , where the anticodon base-pairs with mRNA codons in a wobble-tolerant manner, allowing a reduced set of tRNAs (often around 40-50 per ) to decode all 61 sense codons. Beyond translation, tRNAs and their fragments participate in regulatory roles, such as stress responses, , and modulation, highlighting their multifaceted contributions to cellular . The discovery of tRNA occurred in the mid-1950s through experiments led by Mahlon Hoagland, Paul Zamecnik, and Mary Louise Stephenson at the , who identified a soluble RNA fraction in cell extracts that reversibly bound activated , serving as an intermediate in . This breakthrough, building on earlier work by Francis Crick's adaptor , elucidated how genetic information flows from nucleic acids to proteins and laid the foundation for understanding the molecular basis of the . Subsequent structural studies in the 1960s and 1970s, including by researchers like Alexander Rich, confirmed tRNA's intricate folding and evolutionary conservation.

Fundamentals

Overview

Transfer RNA (tRNA) is an essential adaptor molecule that serves as the physical intermediary between the encoded in (mRNA) and the corresponding sequence of proteins during the process of protein synthesis, known as . By recognizing specific triplets, or codons, in mRNA through base-pairing with its anticodon region, tRNA delivers the precise required to build the polypeptide chain at the . The consists of 61 sense codons that specify the 20 standard , with tRNA bridging the nucleic acid-based instructions of mRNA to the protein world by ensuring accurate codon-anticodon matching. This adaptor function, first conceptualized in Francis Crick's 1955 , enables the faithful of into functional proteins across diverse biological systems. tRNA is universally present in all living organisms, including prokaryotes and eukaryotes, as well as in organelles such as mitochondria and chloroplasts, where it supports independent translation machinery derived from endosymbiotic origins. Eukaryotic cells typically contain 40–60 distinct tRNA species, sufficient to decode the 61 codons due to the wobble allowing some tRNAs to recognize multiple synonymous codons. In terms of cellular abundance, tRNA constitutes approximately 10–15% of the total RNA in cells, reflecting its critical and high-demand role in sustaining ongoing protein synthesis.

Nomenclature

Transfer RNA, abbreviated as tRNA, is the standard short form for its full name, transfer ribonucleic acid. This nomenclature reflects its role in transferring during protein synthesis, distinguishing it from other RNA types like (mRNA) and (rRNA). Historically, tRNA was first identified in the as a low-molecular-weight RNA fraction that remained soluble during certain fractionation steps, leading to its initial designation as soluble RNA or sRNA. By the early 1960s, as its adaptor function in translation became clear, the term "transfer RNA" was adopted to emphasize its specific role in shuttling to the , replacing the more generic sRNA label. The primary naming convention for tRNAs is based on the specific they carry, using a superscript notation for the three-letter amino acid code, such as tRNA^{Ala} for alanine-specific tRNA or tRNA^{Phe} for phenylalanine-specific tRNA. This system, established in early compilations of tRNA sequences, allows precise identification of the tRNA's charging specificity by aminoacyl-tRNA synthetases. Alternative formats include hyphens, as in tRNA-Ala, particularly in genomic databases like GtRND, where names follow patterns such as tRNA-XXX-YYY (with XXX as the three-letter amino acid code and YYY indicating anticodon specifics). A key aspect of tRNA nomenclature is the distinction among isoacceptors, which are multiple tRNA variants that carry the same but possess different anticodons to decode synonymous codons. For instance, phenylalanine isoacceptor tRNAs include tRNA^{Phe} with anticodons GAA (reading UUC) and AAA (reading UUU), enabling recognition of both codons for while ensuring the same is incorporated. This diversity accommodates the degeneracy of the , with organisms typically having 2–6 isoacceptors per to optimize efficiency. Special nomenclature applies to methionine tRNAs to differentiate their roles in translation initiation and elongation. The initiator form, denoted tRNA^{iMet} or tRNAi^{Met}, is uniquely formylated in prokaryotes (as fMet-tRNA^{iMet}) or unmodified in eukaryotes to bind the ribosomal P-site at start codons. In contrast, the elongator tRNA^{Met} inserts internal methionines during chain extension and shares the same anticodon (CAU) but differs in structural features and modification patterns. This superscript "i" prefix highlights the initiator's specialized function, preventing its misuse in elongation.

Molecular Structure

Primary and Secondary Structure

Transfer RNA (tRNA) molecules possess a primary structure consisting of a linear chain of 70 to 90 ribonucleotides, with the 5' end typically beginning with a and the 3' end terminating in the invariant CCA sequence. This sequence length accommodates the functional elements required for attachment and codon recognition, while conserved positions across tRNAs ensure structural integrity. Among these, approximately 26 positions are invariant or semi-invariant, meaning they are identical or limited to specific bases (purines or pyrimidines) in nearly all tRNAs. Notable examples include the G18-G19 pair in the , which facilitates tertiary interactions, and the U55 position, universally modified to (ψ55), contributing to stability. The secondary structure of tRNA adopts a characteristic cloverleaf model, first elucidated from the sequencing of yeast tRNA, featuring four main stems and four loops formed by intramolecular base pairing. The acceptor stem, formed by base pairing between the 5' and 3' termini (positions 1-7 with 66-72), culminates in the 3' CCA end, the site of covalent attachment during aminoacylation. The D-arm consists of a stem (positions 10-13 paired with 22-25) and a D-loop rich in dihydrouridine modifications; the anticodon arm includes a stem (positions 27-30 paired with 40-43) and the anticodon loop (positions 34-36) for mRNA interaction; and the TψC-arm comprises a stem (positions 49-54 paired with 58-63) and a TψC-loop containing the conserved TψCG sequence. Intercalated between the anticodon and TψC arms is the variable loop, which exhibits significant length variation from 3 to 21 , distinguishing class I tRNAs, which have a short variable loop of 3–5 , from class II tRNAs, which have a longer variable loop of 13–21 that often forms a mini-helix with 4–5 base pairs. Base pairing in the stems primarily follows Watson-Crick rules (A-U, G-C), but non-canonical pairs such as G-U wobbles are prevalent, providing flexibility and stability to the structure; for instance, G-U pairs occur frequently in the D-stem and anticodon stem of various tRNAs. These wobble pairs, conserved across species, distort the helical geometry slightly but enhance overall folding fidelity.

Tertiary Structure

The tertiary structure of transfer RNA (tRNA) adopts a compact L-shaped conformation, resulting from the stacking and orthogonal orientation of its helical domains derived from the cloverleaf secondary structure. The acceptor stem paired with the T-arm forms the elongated arm of the L, extending approximately 70 , while the D-arm paired with the anticodon stem-loop constitutes the shorter arm, also around 70 in effective span, positioning the attachment site at the 3' end far from the anticodon triplet. This architecture was first elucidated through of tRNA^Phe at 3 resolution in , revealing the polynucleotide chain's continuous density and the overall fold's compactness. Stability of the L-shaped fold relies on tertiary interactions beyond the secondary helices, including conserved base pairs such as the 10–25 and 13–22 pairs that bridge the D- and T-loops to form the "" region at the bend of the L. Additional hydrogen bonds and non-canonical base triples in the core further reinforce this , while divalent magnesium ions (Mg^2+^) coordinate with groups to neutralize electrostatic repulsion and lock the structure, with contact ion pairs embedded in hydration shells contributing significantly to the folded equilibrium. These elements ensure the molecule's rigidity under physiological conditions, with Mg^2+^ concentrations above 1 mM promoting tight packing of the two domains. The tertiary fold exhibits conformational dynamics, with local fluctuations in loop regions allowing transitions between relatively open and closed states that modulate flexibility without disrupting the overall L-shape, as observed in molecular dynamics simulations and NMR studies. This core structure is highly conserved across prokaryotes and eukaryotes, particularly in the elbow region where D-T loop interactions maintain the perpendicular domain orientation, though eukaryotic tRNAs may incorporate additional modifications that subtly enhance stability in the variable loop adjacent to the elbow.

Anticodon and Recognition Sites

The anticodon loop of transfer RNA (tRNA) is a conserved structural feature consisting of a seven-nucleotide single-stranded region that protrudes from the anticodon stem in the L-shaped tertiary of the molecule. This loop positions the three critical anticodon nucleotides at positions 34, 35, and 36, which directly base-pair with the corresponding codon on (mRNA) during protein synthesis. The loop is flanked by a five-base-pair stem, and its sequence typically begins with a conserved at position 33, which facilitates a sharp motif that reverses the direction of the backbone, enhancing flexibility and proper presentation of the anticodon for codon recognition. This U-turn is stabilized by hydrogen bonding between the uridine at position 33 and the nucleotide at position 35, allowing the anticodon bases to extend outward for efficient pairing. A key aspect of anticodon function is the wobble hypothesis, which explains how tRNAs can decode multiple synonymous codons despite the degeneracy of the . Proposed by , this hypothesis posits that the first base of the anticodon (position 34, known as the wobble position) permits non-standard base pairing with the third base of the mRNA codon, reducing the number of required tRNA species. For instance, at position 34 can pair with either or in the codon, enabling a single tRNA to recognize two codons differing in the third position. This flexibility is crucial for efficient , as it accommodates the 61 sense codons with fewer than 61 tRNAs. Post-transcriptional modifications in the anticodon loop further refine recognition specificity and stability. Notably, at position 34, formed by , allows pairing with , , or uracil in the codon, expanding the decoding capacity of certain tRNAs, such as those for and . These modifications, concentrated in the anticodon loop, prevent aberrant pairing and enhance fidelity by altering base geometry and hydrogen bonding patterns. Recognition sites beyond the anticodon are essential for tRNA aminoacylation, where specific identity elements in the tRNA sequence are recognized by synthetases (aaRS). These elements include in the anticodon and the acceptor stem, with the discriminator base at position 73 (often , A73) playing a pivotal role in synthetase binding and specificity. For example, A73 serves as a major determinant for many aaRS, influencing the correct attachment of by modulating enzyme-tRNA interactions and preventing misacylation. Other identity elements, such as specific bases in the anticodon (e.g., positions 34-36 for certain synthetases), act in concert to ensure high-fidelity charging, with their locations varying by specificity across organisms.

Function in Translation

Aminoacylation

Aminoacylation is the essential process by which specific are covalently attached to their cognate transfer RNAs (tRNAs), enabling the accurate translation of genetic information into proteins. This reaction is catalyzed by aminoacyl-tRNA synthetases (aaRSs), a family of 20 enzymes in most organisms, each dedicated to one of the 20 standard . The process ensures that each tRNA carries the correct corresponding to its anticodon, a prerequisite for faithful protein synthesis. The aminoacylation reaction occurs in two discrete steps. In the first activation step, the aaRS binds the and ATP, forming an aminoacyl-adenylate (aminoacyl-AMP) intermediate and releasing inorganic (PPi). This high-energy intermediate positions the carboxyl group of the for nucleophilic attack. In the second transfer step, the activated aminoacyl group is ligated to the 3'-terminal of the tRNA, specifically the 2'- or 3'-hydroxyl group depending on the aaRS class, forming a stable bond and releasing (AMP). The overall process consumes the energetic equivalent of two bonds from ATP, as the released PPi is subsequently hydrolyzed by pyrophosphatase to drive the reaction forward irreversibly. aaRS enzymes are structurally classified into two distinct classes based on their catalytic domains. Class I aaRSs, which include synthetases for amino acids such as , , and , feature a Rossmann nucleotide-binding fold and typically attach the aminoacyl group to the 2'-OH of the tRNA terminal . In contrast, Class II aaRSs, responsible for amino acids like , , and , possess an antiparallel β-sheet core and acylate the 3'-OH. This structural dichotomy reflects evolutionary divergence while maintaining functional specificity, with each class encompassing synthetases for roughly half of the 20 . To achieve high fidelity despite the chemical similarities among , aaRSs employ () mechanisms that correct errors in amino acid selection. These include pre-transfer editing, where non-cognate aminoacyl-AMP intermediates are hydrolyzed before transfer, and post-transfer editing, which hydrolyzes incorrectly charged aminoacyl-tRNAs after bond formation. For instance, isoleucyl-tRNA synthetase hydrolyzes misactivated valyl-AMP or valyl-tRNA^Ile^ to prevent incorporation of at codons, ensuring accuracy rates exceeding 99.9%. Such editing domains are integral to many aaRSs, particularly those charging physicochemically similar .

Ribosome Binding and Decoding

The ribosome features three primary tRNA-binding sites that facilitate the process: the A-site, where decoding occurs and the incoming (aa-tRNA) initially binds; the P-site, which holds the peptidyl-tRNA for formation; and the E-site, from which deacylated tRNA exits after translocation.02064-9) These sites ensure ordered progression of tRNAs during protein synthesis, with the A-site serving as the entry point for codon recognition. In the decoding process, the ternary complex of aa-tRNA, GTP, and elongation factor Tu (EF-Tu) in prokaryotes—or its eukaryotic homolog eEF1A—delivers the aa-tRNA to the A-site of the . Upon initial codon-anticodon pairing in the A-site, the ribosome undergoes an induced fit conformational change, stabilizing interactions while rejecting near- or non- tRNAs. This recognition triggers GTP hydrolysis by EF-Tu or eEF1A, which accelerates the release of the factor and allows tRNA accommodation into the A-site for subsequent formation. In eukaryotes, decoding involves additional structural rearrangements in the , distinct from prokaryotic mechanisms, enhancing through prolonged monitoring of the codon-anticodon duplex. Kinetic proofreading enhances decoding accuracy by introducing a GTP hydrolysis step that divides tRNA selection into initial selection and proofreading phases, allowing erroneous tRNAs to dissociate before irreversible accommodation. During proofreading, near-cognate aa-tRNAs are rejected at higher rates following EF-Tu dissociation, achieving error rates as low as 10^{-4} for mistranslation. This two-step mechanism amplifies discrimination beyond simple base-pairing thermodynamics. Wobble pairing, particularly at the third position of the codon, enables a single tRNA to recognize multiple synonymous codons, reducing the number of required tRNAs while maintaining code degeneracy. Post-transcriptional modifications at the tRNA wobble position (position 34) fine-tune this flexibility, influencing base-pairing monitored by the ribosomal decoding . For instance, at the wobble site allows pairing with U, C, or A, exemplifying how structural adaptations promote efficient decoding without compromising specificity. Following initial recognition, the tRNA undergoes accommodation into the A-site, involving domain rearrangements where the tRNA body rotates and the CCA end aligns for peptidyl transfer, a process accelerated by GTP hydrolysis. Cryo-EM structures reveal that this step includes transient interactions stabilizing the codon-anticodon helix within the small subunit's decoding center.

Role in Elongation and Termination

During the elongation phase of , the facilitates formation between the growing polypeptide chain attached to the tRNA in the and the carried by the incoming (aa-tRNA) positioned in the A-site. The peptidyl transferase center, an RNA-based within the large ribosomal subunit, catalyzes this nucleophilic attack by positioning the α-amino group of the A-site aa-tRNA to attack the carbonyl carbon of the peptidyl-tRNA bond in the , resulting in chain elongation without external energy input beyond GTP in prior steps.00185-2) Following formation, the ribosome enters a hybrid state where the anticodons of both tRNAs remain paired with their mRNA codons, but the peptidyl-tRNA shifts to an hybrid position and the deacylated tRNA to a P/E hybrid, priming translocation. In prokaryotes, G (EF-G), bound to GTP, interacts with the ribosome to drive the unidirectional movement of the tRNAs and mRNA, relocating the new peptidyl-tRNA to the P-site, the deacylated tRNA to the E-site for subsequent exit, and advancing the mRNA by one codon to expose the next codon in the A-site. In eukaryotes, the homologous 2 (eEF2) performs this GTP-dependent translocation, ensuring efficient cycling through multiple rounds of elongation to build the polypeptide. The deacylated tRNA is then ejected from the E-site, completing the cycle and maintaining high throughput, with ribosomes capable of adding up to 20 per second in prokaryotes. Translation elongation achieves high fidelity, with error rates approximately 1 in 10,000 codons incorporated, primarily due to kinetic during tRNA selection and translocation that discriminates against near-cognate tRNAs. Upon encountering a in the A-site, translation terminates as class I release factors—RF1 or RF2 in prokaryotes, which recognize UAA/UGA or UAA/UAG respectively, and eRF1 in eukaryotes, which decodes all three stop codons (UAA, UAG, UGA)—bind to the ribosomal A-site in a tRNA-mimetic manner.81331-8)80667-4) These factors induce a conformational change in the peptidyl transferase center, positioning a conserved GGQ motif to activate a molecule for of the ester bond linking the completed polypeptide to the P-site tRNA, releasing the nascent chain. In prokaryotes, RF3 () then promotes release factor dissociation, while in eukaryotes, eRF3 assists similarly; recycling factor ABCE1 or homologs subsequently disassemble the post-termination .00263-X) Specialized suppressor tRNAs, often arising from in standard tRNA genes, can compete with release factors by base-pairing with stop codons via altered anticodons, inserting an and allowing of premature termination signals; for example, amber suppressor tRNAs (supE or supF in E. coli) recognize UAG and insert or , respectively, enabling continued elongation.90438-5.pdf) Such suppressors occur naturally at low frequencies but are harnessed in genetic studies and to rescue nonsense .

Genetics and Evolution

tRNA Genes and Genomic Organization

Transfer RNA (tRNA) genes are primarily encoded in the nuclear genome of eukaryotes, where they exist in multiple copies to support the high demand for tRNA molecules during protein synthesis. In the budding yeast Saccharomyces cerevisiae, there are 275 nuclear-encoded tRNA genes, which collectively decode all 61 sense codons through 42 distinct tRNA species. In humans, the nuclear genome harbors approximately 610 tRNA genes, though nearly half are pseudogenes that do not produce functional tRNAs. These pseudogenes represent non-functional duplicates arising from gene duplication events, and their presence contributes to the overall redundancy in the tRNA gene repertoire. tRNA genes feature a conserved structure adapted for transcription by (Pol III). They contain internal promoter elements known as the A-box (typically located 8-19 downstream of the transcription start site) and the B-box (52-62 downstream), which are recognized by the TFIIIC to recruit Pol III and initiate synthesis. In eukaryotes, a subset of tRNA genes includes a single positioned at the anticodon loop (nucleotide 37/38), with the frequency varying by ; for instance, approximately 20% of tRNA genes (59 out of 275) contain such introns, while in humans, only about 7% of the ~400 potentially active genes do. These introns are removed during tRNA maturation but play roles in splicing regulation. Organelle-specific tRNA genes exhibit reduced diversity due to deviations in the genetic code and import mechanisms. The human mitochondrial genome encodes 22 tRNA genes, sufficient to translate the 13 mitochondrially encoded proteins using a modified code that reassigns certain codons. Similarly, chloroplast genomes in plants typically encode 30-37 tRNA genes, but many additional tRNAs are imported from the nuclear-cytosolic pool to supplement translation of chloroplast-encoded proteins. These organellar tRNAs often lack certain nuclear-encoded modifications and show structural adaptations for their environments. The of tRNA genes varies across , featuring both dispersed and clustered arrangements. In , the 275 tRNA genes are scattered across but show spatial clustering near centromeres (58%) and nucleolar regions, facilitating coordinated transcription. In vertebrates, tRNA genes are often found in arrays or large clusters; for example, humans have a prominent cluster of 157 tRNA genes at chromosome 6p22.2, with overall 17-36% of genes organized in such clusters, reflecting lineage-specific expansions. This organization influences structure and expression efficiency, with pseudogenes interspersed among functional loci.

Evolutionary Origins

The core structure of transfer RNA (tRNA) is highly conserved across all domains of life, suggesting its emergence predates the (LUCA). Analyses of tRNA sequences and structures indicate that the L-shaped tertiary fold and key functional elements, such as the acceptor stem and anticodon loop, were likely present in the common ancestor of , , and eukaryotes. This conservation is evidenced by the near-universal retention of a 31-nucleotide minihelix precursor, which formed the basis for the modern tRNA's coaxial stacking of stems. In the RNA world hypothesis, tRNA is posited to have originated as a proto-ribozyme capable of ligating to RNA oligomers, facilitating the transition from RNA-based to protein synthesis. Early tRNA-like molecules may have functioned in aminoacylation without protein catalysts, using ribozyme activity to attach via bonds at the 3' CCA end. The "genomic tag" hypothesis further proposes that the upper half of tRNA (acceptor stem and T-arm) evolved first as a terminal tag on RNA genomes, marking 3' ends for replication by ribozymes like RNase P, with the anticodon domain added later to adapt for . tRNA evolution coevolved with the , expanding from an initial set of fewer than 20 to the modern 20 through stepwise incorporation of new codons and synthetases. The wobble hypothesis, allowing non-standard base pairing at the anticodon's , minimized the required number of tRNA from to around 32-40, enabling efficient decoding with fewer isoacceptors. This degeneracy likely arose to accommodate code expansion while maintaining translational fidelity. In eukaryotic organelles, tRNA evolution reflects endosymbiotic transfer from bacterial ancestors to the nucleus, with most mitochondrial and tRNAs encoded in the organelle but some imported from the . Mitochondrial tRNAs exhibit deviations from the universal code, such as AUA decoding as rather than , enabled by and specific modifications like 5-formylcytosine at the anticodon wobble position. These changes arose post-endosymbiosis to adapt to reduced gene sets and altered codon usage. Comparative genomics reveals domain-specific differences in tRNA repertoires: bacterial tRNAs are generally simpler with fewer isodecoders, while archaeal tRNAs show intermediate complexity, and eukaryotic tRNAs possess more extensive post-transcriptional modifications—averaging around 13 per molecule compared to about 8 in prokaryotes—to enhance stability and decoding accuracy in diverse environments.

tRNA-Derived Fragments

Transfer RNA-derived fragments (tRFs), also known as tRNA-derived small RNAs (tsRNAs), are small non-coding RNAs generated from mature or precursor tRNAs through specific cleavage processes. These fragments typically range from 14 to 40 in length and include two main categories: tRNA halves (tiRNAs), which are approximately 30-40 long and produced by cleaving mature tRNAs at the anticodon loop, and shorter tRFs derived from the 5', 3', or TψC loops and other regions. tiRNAs are further subclassified into 5'-tiRNAs and 3'-tiRNAs based on their cleavage site, while tRFs encompass types such as 5'-tRFs, 3'-tRFs (e.g., CCA-tailed or CCA-truncated), and i-tRFs from the or anticodon loop. Stress-induced examples include tiRNA-Ala, which accumulates under hypoxic conditions. Biogenesis of tsRNAs primarily occurs through endonucleolytic cleavage of tRNAs by ribonucleases such as angiogenin (ANG) or , often triggered by cellular stress, , or viral infection. Under stress conditions like or nutrient deprivation, ANG cleaves tRNAs at the anticodon loop to produce tiRNAs, while Dicer-dependent processing generates certain tRFs, particularly those resembling microRNAs. In apoptotic cells, caspase-mediated activation of RNases contributes to tsRNA production, and post-transcriptional modifications on tRNAs, such as m¹A or , influence cleavage site specificity and fragment stability. Unlike mature tRNA processing, tsRNA generation bypasses standard RNase P and RNase Z pathways, instead relying on stress-responsive mechanisms. tsRNAs exert diverse regulatory functions beyond canonical tRNA roles, including gene silencing through association with Argonaute proteins in RNA-induced silencing complexes (RISC), where they target mRNAs for degradation or translational repression. Specific tRFs, such as tRF-1001, inhibit translation by binding to the 80S ribosome and blocking elongation, while tiRNAs suppress global protein synthesis during stress by sequestering translation initiation factors like eIF2α. Additionally, certain tsRNAs, including 5'-tiRNA-Glu, inhibit retrotransposon activity by binding to reverse transcriptase enzymes, thereby preventing genomic insertions. These functions highlight tsRNAs' roles in fine-tuning gene expression and cellular responses to environmental cues. In disease contexts, tsRNAs are frequently upregulated and serve as biomarkers or regulators. In cancer, tRF-1001 is elevated in and colon tumors, promoting proliferation and by modulating pathways, while tiRNAs contribute to tumor via angiogenin signaling. Neurodegenerative disorders, such as , show altered tsRNA profiles, with specific tRFs influencing amyloid-beta aggregation and neuronal survival. tsRNAs also link to cardiovascular diseases by regulating endothelial cell and . Post-2010 research has uncovered tsRNAs' involvement in viral defense and epigenetic regulation. During viral infections, tiRNAs inhibit by suppressing host and interfering with viral protein synthesis, as seen in responses to or viruses. Epigenetically, tsRNAs influence and histone modifications; for instance, 5'-tRFs guide proteins to promoter regions, repressing oncogenes in immune cells. Studies from the 2020s emphasize tsRNAs' roles in innate immunity, where they modulate responses and T-cell differentiation, positioning them as potential therapeutic targets.

Biogenesis and Modifications

Transcription and Processing

In eukaryotes, transfer RNA (tRNA) genes are transcribed by (Pol III), which recognizes internal promoter elements within the transcribed sequence. These promoters consist of two conserved boxes: the A-box, located at 8–19, and the B-box, at 52–62, relative to the mature tRNA structure. The transcription factor complex TFIIIC binds these A- and B-boxes to recruit TFIIIB and Pol III, initiating synthesis of a primary tRNA transcript known as pre-tRNA. This internal promoter architecture allows efficient transcription without reliance on upstream elements, distinguishing Pol III promoters from those of Pol II. In prokaryotes, tRNA transcription is carried out by a single multisubunit , similar to that used for mRNA and rRNA synthesis. Many bacterial tRNA genes are organized into polycistronic s, where multiple tRNA are transcribed as a single long primary transcript from a single promoter, often upstream of the . For instance, in , tRNA genes like those in the valV-valW and leuQ-leuP-leuV s are co-transcribed into polycistronic that require subsequent to yield individual mature tRNAs. This arrangement enables coordinated expression of tRNAs needed for . Maturation of pre-tRNAs begins with endonucleolytic processing to remove flanking sequences. The 5' leader sequence is cleaved by ribonuclease P (RNase P), a ribonucleoprotein complex that generates the mature 5' end in both prokaryotes and eukaryotes. In prokaryotes, RNase P acts on polycistronic transcripts to release individual pre-tRNAs, often in a 5'-to-3' directional manner. The 3' trailer is trimmed by endonuclease RNase Z (also known as or Trz), which cleaves downstream of the discriminator base to produce the pre-tRNA with a mature 3' end, excluding the CCA sequence. In eukaryotes, a subset of pre-tRNAs (about 10-20% in ) contain that must be removed by splicing; this is catalyzed by the tRNA splicing endonuclease (TSEN) complex, which recognizes structural features of the pre-tRNA and excises the intron, followed by ligation of the exons. If the 3' end lacks the conserved CCA triplet required for aminoacylation, it is added post-transcriptionally by a template-independent CCA-adding , also known as tRNA nucleotidyltransferase. This uses CTP and ATP as substrates to polymerize the CCA sequence at the 3' terminus, ensuring functionality even if the primary transcript terminates imprecisely. The process involves sequential addition without a template, guided by recognition of the tRNA's acceptor stem. Quality control mechanisms during processing prevent export of defective tRNAs. In eukaryotes, misfolded pre-tRNAs are retained in the nucleus through surveillance pathways, such as the nuclear tRNA quality control system involving complex and exosome, which degrade aberrant precursors to maintain translational fidelity. This retention ensures only properly processed tRNAs proceed to the for modification and function.

Post-Transcriptional Modifications

Transfer RNA (tRNA) undergoes extensive post-transcriptional modifications, with over 100 distinct types identified across organisms, primarily involving , , and base addition to enhance structural integrity and functional precision. These modifications occur at specific positions, such as (Ψ) formation at U55 in the T-loop, catalyzed by synthases of the Pus family, including Pus4 in and Pus1 in humans. Similarly, N1- (m¹G) at position 37 adjacent to the anticodon is introduced by tRNA Trm5 in eukaryotes, preventing translational frameshifting by stabilizing the codon-anticodon interaction. Other notable examples include wybutosine (yW), a hypermodified at G37 in tRNA, synthesized through a multi-enzyme pathway involving TYW1 and TYW2, which strengthens base pairing and decoding accuracy. Enzymes responsible for these modifications belong to conserved families, such as tRNA methyltransferases (Trm proteins) that use S-adenosylmethionine as a methyl donor for sites like m¹A at A58 or m⁵C at the wobble position 34, and synthases that isomerize without external donors. In the anticodon loop, modifications like queuosine (Q) at position 34 in tRNAs for , aspartate, , and , where the queuine base is acquired from diet or in eukaryotes and incorporated by enzymes such as QTRT1 and QTRT2, influencing efficiency and tRNA stability. Eukaryotes exhibit greater modification diversity—with around 90-100 distinct types known across tRNAs, and individual tRNAs bearing typically 5-20 modifications—compared to , which have fewer, simpler alterations. These modifications collectively stabilize the tRNA's L-shaped secondary structure, reduce conformational flexibility, and optimize interactions, with defects leading to impaired codon recognition and increased error rates. For instance, wybutosine at 37 enhances stacking interactions to prevent +1 frameshifting during elongation. Emerging in epitranscriptomics highlights dynamic roles of these modifications in ; hypomodification of mitochondrial tRNAs, such as τm⁵s²U34 in tRNA-Lys, underlies syndromes like MELAS and MERRF by disrupting protein synthesis. Similarly, reduced queuosine levels correlate with neurodegeneration and cancer progression, underscoring therapeutic potential in targeting modifying enzymes.

Applications and Clinical Relevance

Engineered and Synthetic tRNAs

Suppressor tRNAs are engineered variants of natural tRNAs with anticodon mutations that enable them to recognize premature stop codons, thereby facilitating read-through during translation and inserting a specific amino acid at the site. In Escherichia coli, the amber suppressor Su⁺7, derived from tRNA^Trp, features a CUA anticodon that decodes the UAG stop codon as glutamine, allowing suppression of amber mutations with efficiencies up to 76%. These suppressors have been constructed synthetically using oligonucleotides to introduce precise anticodon changes, enabling their use in amino acid substitution studies for protein engineering. Orthogonal tRNA/ (aaRS) pairs represent a of expansion, where the tRNA and its cognate aaRS are engineered to avoid cross-reactivity with host translation machinery, specifically charging the tRNA with an unnatural (UAA). Pioneered by Peter Schultz's group, this approach uses amber suppression with an orthogonal tRNA^CUA and a mutated aaRS to incorporate UAAs at UAG sites in response to an amber codon in the target mRNA. A notable example is the incorporation of p-azido-L-phenylalanine, which enables site-specific photocrosslinking and for protein labeling and conjugation. Synthetic tRNAs are produced through transcription, typically using to generate unmodified transcripts that can be chemically aminoacylated or used directly in reconstituted systems. Minimal synthetic tRNAs, shortened to as few as 49 while retaining core structural elements like the acceptor stem and anticodon, have demonstrated functionality in aminoacylation and ribosomal decoding, highlighting the modularity of tRNA architecture for custom designs. These engineered and synthetic tRNAs enable by allowing site-specific UAA incorporation, expanding the to include over 100 diverse UAAs with novel properties such as , photocrosslinking, or metal . In therapeutics, suppressor tRNAs have shown promise for treating nonsense mutations in diseases like , where optimized variants enable partial restoration of full-length CFTR protein (up to ~14% of wild-type function) by read-through of premature termination codons without significantly disrupting normal . Recent advances in the 2020s include CRISPR-based delivery of suppressor tRNA genes into mammalian cells, achieving efficient nonsense suppression for applications, and integration into for creating orthogonal translation systems in non-natural environments.

Diseases and Therapeutic Implications

Mutations in genes encoding tRNA synthetases, such as RARS2, which charges mitochondrial tRNA^Arg with , cause pontocerebellar type 6 (PCH6), a severe autosomal recessive disorder characterized by cerebellar and pontine , , and early-onset . These mutations impair mitochondrial translation, leading to defective and progressive neurodegeneration, as observed in multiple families with biallelic RARS2 variants. Similarly, variants in other mitochondrial tRNA synthetase genes, like DARS2, result in with and involvement and lactate elevation (LBSL), highlighting tRNA charging defects as a recurring mechanism in mitochondrial encephalomyopathies. Defects in tRNA by synthetases contribute to protein misfolding and neurodegeneration; for instance, editing-deficient alanyl-tRNA synthetase (AARS) in mice leads to accumulation of mischarged tRNAs, triggering intracellular protein aggregates in neurons and behavioral deficits reminiscent of (ALS). In the context of infectious diseases, tRNA^Lys3 serves as the primer for HIV-1 during viral genome replication, and disruptions in its annealing or modification can inhibit reverse transcription, offering a potential antiviral target. Hypomodification of tRNAs, such as reduced m^1A58 in tRNA^Leu(UUR), is linked to ; polymorphisms in CDKAL1, which methylates this site, impair beta-cell function and insulin secretion in both cohorts and mouse models. In cancer, tRNA-derived fragments (tRFs) act as oncogenic regulators by promoting and inhibiting ; for example, the 3'-tRF-Val derived from tRNA^Val is upregulated in gastric cancer tissues, correlating with advanced tumor stages and enhanced migration via interaction with oncogenes like HMGB1. Similarly, tRF-03357 from tRNA^Glu promotes proliferation and invasion in high-grade serous by suppressing HMBOX1 expression, underscoring tRFs' role in tumor progression across multiple malignancies. Genetic variants influencing tRF biogenesis further contribute to cancer susceptibility, as shown in genome-wide association studies linking tRF expression to and cancers. Therapeutically, engineered suppressor tRNAs delivered via lipid nanoparticles (LNPs) carrying their encoding mRNA enable read-through at premature termination codons in diseases like , achieving suppression efficiencies up to ~70% in preclinical models with minimal off-target effects, and show potential for . For antibiotic resistance, external guide sequence antisense targeting bacterial mRNAs involved in tRNA charging pathways, such as aac(6')-Ib in aminoglycoside-resistant strains, induce RNase P cleavage and restore susceptibility . Emerging tRNA-based gene therapies, including chemically modified tRNAs to enhance of therapeutic proteins, show promise in treating genetic disorders by boosting suppressor activity . tRNA modifications serve as diagnostic biomarkers in oncology; for instance, altered queuosine (Q) levels at the wobble position of tRNA^Asn and tRNA^Tyr, catalyzed by TGT enzyme, correlate with leukemia progression, with Q-deficient tRNAs elevated in acute myeloid leukemia cells as potential indicators of poor prognosis. In neurodegeneration, recent 2025 studies (as of November 2025) reveal disease-specific tRNA fragment profiles, such as increased tRF expression in Alzheimer's disease models derived from iPSC neurons, suggesting tRNA-derived signatures for early detection. Loss-of-function mutations in tRNA modification enzymes like TRMT1 cause neurodevelopmental disorders with hypomodified tRNAs, further implicating modification defects in cognitive decline across dementias.

Historical Development

Discovery and Early Characterization

In the mid-1950s, researchers at the , including Mahlon B. Hoagland, Paul C. Zamecnik, and Mary Louise Stephenson, were investigating protein synthesis using cell-free extracts from rat liver. They observed that activated , formed by attachment to (AMP) via specific enzymes, were rapidly bound to a fraction of that remained soluble in the supernatant after high-speed centrifugation. This RNA, initially called "soluble RNA" (sRNA) or "pH 5 enzyme RNA," served as a carrier for these aminoacyl groups, preventing their immediate incorporation into proteins and suggesting an intermediate role in translation. Their seminal 1957 paper in detailed how each of the 20 common could be specifically attached to this sRNA fraction, laying the groundwork for understanding and transfer. Early experiments further elucidated sRNA's function as an adaptor molecule. Using pulse-labeling techniques with radioactive , Hoagland and colleagues demonstrated that labeling occurred first on sRNA within seconds, followed by slower transfer to nascent polypeptide chains on ribosomes. This temporal pattern, reported in 1958 in the , confirmed sRNA's role in bridging to the ribosomal machinery, aligning with Francis Crick's 1955 adaptor hypothesis. By 1961, as biochemical and genetic studies clarified its transfer function during protein synthesis, multiple groups—including those led by Zamecnik and François Gros—renamed it "transfer RNA" (tRNA) to reflect this specific role. A major advance came in 1965 when Robert W. Holley and his team at achieved the first complete isolation and sequencing of a pure tRNA species: alanine tRNA from . This feat required processing over 1,400 pounds of yeast to yield just 1 gram of purified material, using techniques like countercurrent distribution and . Published in the , the 77-nucleotide sequence revealed tRNA's cloverleaf secondary structure, with an anticodon loop for codon recognition and an acceptor stem for attachment, providing the first direct evidence of its molecular architecture. This work not only validated tRNA's adaptor function but also enabled early efforts to decipher the . The foundational contributions to tRNA discovery were recognized in 1968, when Holley shared the in Physiology or Medicine with and Marshall W. Nirenberg. Their collective efforts—Holley's structural elucidation of tRNA, Khorana's of to probe codon assignments, and Nirenberg's cell-free translation systems—unraveled how genetic information is translated into proteins via tRNA. The Nobel citation highlighted tRNA's central role in interpreting the , marking a pivotal moment in .

Key Milestones and Advances

In the , significant strides were made in elucidating the three-dimensional architecture of tRNA, building on the secondary structure proposed earlier. The cloverleaf model, initially suggested based on , was experimentally confirmed through , revealing the conserved secondary structural elements such as stems and loops. A landmark achievement came in 1974 with the determination of the first atomic-resolution structure of yeast phenylalanyl-tRNA (tRNA^{Phe}) at 3 Å resolution, which demonstrated the L-shaped tertiary fold where the acceptor stem and T-arm form one arm, and the D-arm and anticodon arm form the other, oriented at a . This structure by Kim, Rich, and colleagues provided the foundational model for understanding tRNA's role in bridging mRNA and protein synthesis. The 1980s advanced insights into tRNA charging mechanisms and genetic manipulation. Structural studies illuminated the aminoacylation process, with the first crystallization of a tRNA-aminoacyl-tRNA synthetase (aaRS) complex achieved in 1980 using yeast aspartyl-tRNA synthetase and tRNA^{Asp}, enabling subsequent atomic models that revealed how aaRS enzymes recognize specific tRNA identity elements for accurate attachment. Pioneering work also introduced suppressor tRNAs for expanding the ; in 1989, engineered amber suppressor tRNAs were used to incorporate an unnatural (para-fluorophenylalanine) into proteins in a cell-free synthesis system from E. coli, marking an early step toward site-specific noncanonical incorporation. Subsequent work in the early 1990s extended this to incorporation in eukaryotic cells, such as , using chemically aminoacylated suppressor tRNAs. During the 1990s and 2000s, genomic sequencing projects unveiled the organization and diversity of tRNA genes across organisms. Analysis of complete genomes, such as the genome in 1996, identified multicopy tRNA gene families—often 10–20 isoacceptors per —clustered in specific loci and revealing evolutionary conservation alongside species-specific variations in anticodon usage. Refinements to the wobble hypothesis emerged, with the 1991 modified-wobble hypothesis proposing that specific post-transcriptional modifications at the anticodon wobble position (e.g., queuosine or wybutosine) restrict or expand codon recognition, explaining observed deviations from Crick's original 1966 rules through structural constraints on base pairing. In the , high-throughput sequencing technologies revolutionized the study of tRNA modifications and derived fragments. Methods like DM-tRNA-seq, developed around , enabled quantitative detection and mapping of over 100 tRNA modifications (e.g., m^1A and i^6A) at single- resolution by using demethylases to facilitate reverse transcription, uncovering dynamic modification patterns linked to fidelity. Concurrently, the discovery of tRNA-derived fragments (tRFs) and stress-induced tiRNAs in 2009 highlighted their regulatory roles; these 18–40 RNAs, generated by angiogenin cleavage under stress, inhibit initiation by binding to 4A and modulate in cancer and neurodegeneration. Recent advances in the 2020s have leveraged cryo-electron microscopy (cryo-EM) and computational tools for deeper mechanistic insights and . High-resolution cryo-EM structures (2.5–3.5 Å) of tRNA-ribosome complexes, such as those from 2020 onward, have captured transient states during translocation and accommodation, revealing how tRNA conformational dynamics and modifications influence peptidyl transfer and frameshifting. In synthetic biology, genetic code expansion progressed with orthogonal tRNA/aaRS pairs enabling incorporation of over 200 noncanonical amino acids.

References

  1. https://www.tandfonline.com/doi/full/10.1080/15476286.2018.1478942
  2. https://pmc.ncbi.nlm.nih.gov/articles/PMC4695843/
  3. https://www.nature.com/articles/s41422-018-0013-y
  4. https://www.ncbi.nlm.nih.gov/books/NBK6236/
  5. https://www.sciencedirect.com/science/article/pii/S0141813017348535
  6. https://www.jbc.org/article/S0021-9258%2820%2979029-0/fulltext
  7. https://wires.onlinelibrary.wiley.com/doi/abs/10.1002/wrna.103
  8. https://pmc.ncbi.nlm.nih.gov/articles/PMC7954030/
  9. https://www.ncbi.nlm.nih.gov/books/NBK26829/
  10. https://pmc.ncbi.nlm.nih.gov/articles/PMC6103721/
  11. https://bionumbers.hms.harvard.edu/bionumber.aspx?s=n&v=1&id=107235
  12. https://www.genome.gov/genetics-glossary/Transfer-RNA-tRNA
  13. https://iupac.qmul.ac.uk/misc/naabb.html
  14. http://library.cshl.edu/oralhistory/interview/cshl/history/1956-discovery-transfer-rna/
  15. https://www.genenames.org/data/genegroup/#!/group/478
  16. https://academic.oup.com/nar/article/26/1/148/2376733
  17. https://murawalalab.mdibl.org/nomenclature/
  18. https://genesdev.cshlp.org/content/18/7/731.full
  19. https://www.micropublication.org/journals/biology/micropub-biology-000560/
  20. https://pmc.ncbi.nlm.nih.gov/articles/PMC2795131/
  21. https://www.sciencedirect.com/topics/pharmacology-toxicology-and-pharmaceutical-science/transfer-rna
  22. https://academic.oup.com/femsre/article/23/3/335/579240
  23. https://pmc.ncbi.nlm.nih.gov/articles/PMC6337575/
  24. https://www.science.org/doi/10.1126/science.147.3664.1462
  25. https://pmc.ncbi.nlm.nih.gov/articles/PMC2848691/
  26. https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/transfer-rna
  27. https://www.sciencedirect.com/science/article/pii/S0021925823019944
  28. https://www.embopress.org/doi/abs/10.1093/embo-reports/kvd001
  29. https://www.annualreviews.org/doi/pdf/10.1146/annurev.bi.45.070176.004105
  30. https://www.nature.com/articles/248020a0
  31. https://www.pnas.org/doi/10.1073/pnas.0606409103
  32. https://pubs.acs.org/doi/10.1021/acs.jpcb.0c08966
  33. https://academic.oup.com/nar/article/50/4/2334/6523812
  34. https://pmc.ncbi.nlm.nih.gov/articles/PMC10424219/
  35. https://pmc.ncbi.nlm.nih.gov/articles/PMC7373986/
  36. https://febs.onlinelibrary.wiley.com/doi/10.1002/1873-3468.70098
  37. https://www.sciencedirect.com/science/article/pii/S0167488920302470
  38. https://pmc.ncbi.nlm.nih.gov/articles/PMC4062602/
  39. https://www.frontiersin.org/journals/bioengineering-and-biotechnology/articles/10.3389/fbioe.2022.918659/full
  40. https://www.nature.com/articles/s41467-024-55183-0
  41. https://academic.oup.com/nar/article/51/19/10606/7281665
  42. https://www.cell.com/trends/biochemical-sciences/fulltext/S0968-0004(03)00066-5
  43. https://www.nature.com/articles/s41586-023-05908-w
  44. https://www.pnas.org/doi/10.1073/pnas.1904469117
  45. https://www.pnas.org/doi/10.1073/pnas.1721431115
  46. https://www.pnas.org/doi/10.1073/pnas.1610917113
  47. https://www.nature.com/articles/ncomms10457
  48. https://www.pnas.org/doi/10.1073/pnas.0708517104
  49. https://www.pnas.org/doi/10.1073/pnas.0403884101
  50. https://www.nature.com/articles/s41586-021-03713-x
  51. https://www.pnas.org/doi/10.1073/pnas.0909640107
  52. https://www.nature.com/articles/s41467-023-38077-5
  53. https://www.nature.com/articles/s41467-019-10608-z
  54. https://www.pnas.org/doi/10.1073/pnas.1003995107
  55. https://www.pnas.org/doi/10.1073/pnas.1501558112
  56. https://www.nature.com/articles/s41467-019-08329-4
  57. https://pmc.ncbi.nlm.nih.gov/articles/PMC6688141/
  58. https://pmc.ncbi.nlm.nih.gov/articles/PMC4884153/
  59. https://febs.onlinelibrary.wiley.com/doi/10.1016/j.febslet.2009.11.053
  60. https://www.cell.com/molecular-cell/pdf/S1097-2765%2825%2900053-X.pdf
  61. https://www.nature.com/articles/s41580-020-0220-5
  62. https://pmc.ncbi.nlm.nih.gov/articles/PMC8524817/
  63. https://www.sciencedirect.com/science/article/pii/S0006349519344297
  64. https://www.nature.com/articles/s41467-021-22639-6
  65. https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-11-270
  66. https://pmc.ncbi.nlm.nih.gov/articles/PMC5066508/
  67. https://pmc.ncbi.nlm.nih.gov/articles/PMC7151597/
  68. https://biologydirect.biomedcentral.com/articles/10.1186/1745-6150-5-65
  69. https://www.tandfonline.com/doi/full/10.1080/21541264.2018.1429837
  70. https://academic.oup.com/mbe/article/36/4/650/5261345
  71. https://www.pnas.org/doi/10.1073/pnas.1633606100
  72. https://www.nature.com/articles/s41467-020-18068-6
  73. https://journals.asm.org/doi/10.1128/microbiolspec.rwr-0015-2017
  74. https://www.mdpi.com/2218-273X/7/1/26
  75. https://pmc.ncbi.nlm.nih.gov/articles/PMC8897278/
  76. https://www.nature.com/articles/s41419-021-04472-3
  77. https://www.tandfonline.com/doi/full/10.1080/15476286.2021.1922009
  78. https://pmc.ncbi.nlm.nih.gov/articles/PMC6315542/
  79. https://molecular-cancer.biomedcentral.com/articles/10.1186/s12943-024-01992-2
  80. https://www.frontiersin.org/journals/cardiovascular-medicine/articles/10.3389/fcvm.2025.1622248/full
  81. https://www.cell.com/molecular-therapy-family/nucleic-acids/fulltext/S2162-2531%2824%2900001-5
  82. https://onlinelibrary.wiley.com/doi/full/10.1002/ctd2.221
  83. https://www.sciencedirect.com/science/article/pii/S2352304224001235
  84. https://portlandpress.com/biochemsoctrans/article/44/5/1367/65672/Transcription-by-RNA-polymerase-III-insights-into
  85. https://royalsocietypublishing.org/doi/10.1098/rsob.170001
  86. https://pmc.ncbi.nlm.nih.gov/articles/PMC4542688/
  87. https://pmc.ncbi.nlm.nih.gov/articles/PMC2190699/
  88. https://academic.oup.com/nar/article/48/5/2564/5716937
  89. https://www.nature.com/articles/s41467-025-60002-1
  90. https://academic.oup.com/nar/article/47/3/1451/5212008
  91. https://www.embopress.org/doi/10.1038/s44318-024-00297-w
  92. https://pmc.ncbi.nlm.nih.gov/articles/PMC10485636/
  93. https://pmc.ncbi.nlm.nih.gov/articles/PMC3925840/
  94. https://www.pnas.org/doi/10.1073/pnas.0801971105
  95. https://pmc.ncbi.nlm.nih.gov/articles/PMC4438251/
  96. https://www.mdpi.com/1422-0067/16/1/1873
  97. https://academic.oup.com/nar/article/25/22/4493/2359615
  98. https://pmc.ncbi.nlm.nih.gov/articles/PMC2995409/
  99. https://www.embopress.org/doi/10.1038/sj.emboj.7601105
  100. https://www.embopress.org/doi/10.15252/embj.201899777
  101. https://pmc.ncbi.nlm.nih.gov/articles/PMC10969862/
  102. https://pmc.ncbi.nlm.nih.gov/articles/PMC11301382/
  103. https://www.frontiersin.org/journals/molecular-neuroscience/articles/10.3389/fnmol.2017.00135/full
  104. https://pmc.ncbi.nlm.nih.gov/articles/PMC11755703/
  105. https://www.pnas.org/doi/pdf/10.1073/pnas.83.17.6548
  106. https://berg-emeritusprof.stanford.edu/PDFs/PUB5_PNAS-1969-Soll-392-9.pdf
  107. https://pubmed.ncbi.nlm.nih.gov/2193162/
  108. https://www.semanticscholar.org/paper/A-general-approach-for-the-generation-of-orthogonal-Wang-Schultz/a552a57c1ceda7b16349060566e2159043a3c475
  109. https://www.science.org/doi/10.1126/science.2649980
  110. https://pubmed.ncbi.nlm.nih.gov/12148987/
  111. https://pmc.ncbi.nlm.nih.gov/articles/PMC6267555/
  112. https://pubmed.ncbi.nlm.nih.gov/23958440/
  113. https://www.jbc.org/article/S0021-9258%2819%2940548-6/pdf
  114. https://www.nature.com/articles/s41586-023-06133-1
  115. https://academic.oup.com/nar/article/doi/10.1093/nar/gkaf675/8198046
  116. https://pubmed.ncbi.nlm.nih.gov/27683254/
  117. https://pubmed.ncbi.nlm.nih.gov/22086604/
  118. https://pubmed.ncbi.nlm.nih.gov/26970947/
  119. https://pubmed.ncbi.nlm.nih.gov/16906134/
  120. https://pubmed.ncbi.nlm.nih.gov/12049192/
  121. https://pubmed.ncbi.nlm.nih.gov/24581449/
  122. https://www.nature.com/articles/s41419-022-04930-6
  123. https://pubmed.ncbi.nlm.nih.gov/31496739/
  124. https://pubmed.ncbi.nlm.nih.gov/40773675/
  125. https://pubmed.ncbi.nlm.nih.gov/17387154/
  126. https://www.nature.com/articles/s41467-025-62981-7
  127. https://www.nature.com/articles/s41598-024-83451-y
  128. https://alz-journals.onlinelibrary.wiley.com/doi/abs/10.1002/alz.091675
  129. https://pubmed.ncbi.nlm.nih.gov/40069083/
  130. https://faseb.onlinelibrary.wiley.com/doi/full/10.1096/fj.05-1002ufm
  131. https://www.jbc.org/article/S0021-9258(19)48443-3/fulltext
  132. https://www.nobelprize.org/prizes/medicine/1968/summary/
  133. https://pubmed.ncbi.nlm.nih.gov/4601792/
  134. https://www.jbc.org/article/S0021-9258(20)77999-5/fulltext
  135. https://www.jbc.org/article/S0021-9258(18)40261-X/fulltext
  136. https://pubmed.ncbi.nlm.nih.gov/1799628/
  137. https://www.cell.com/structure/fulltext/S0969-2126(20)30369-1
Add your contribution
Related Hubs
User Avatar
No comments yet.